Sequence ID | >W1610019062 |
Genome ID | ARPW01000266 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | halophilic archaeon J07HX5 [ARPW] |
Start position on genome | 788 |
End posion on genome | 702 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
acggatctgT |
tRNA gene sequence |
GCGAGGGTAGCCAAGCCTGGCCAACGGCGGCGGACTCAAGATCCGCTCTCGAAGGAGTCC |
Downstream region at tRNA end position |
gtttttgcct |
Secondary structure (Cloverleaf model) | >W1610019062 Leu CAA T ATtg gtttttgcct G - C C - G G - C A - T G - C G - C G - C T A T T T C C C A C C G A A | | | | | G T A C C G A A G G G C G | | | T T G C G G C C C A A G TCTCGAAGGAGTCC G - C C - G G - C G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |