Sequence ID | >W1610020485 |
Genome ID | ASMJ01000005 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Crenarchaeota archaeon SCGC AAA471-O08 [ASMJ] |
Start position on genome | 39007 |
End posion on genome | 38932 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aataatagtT |
tRNA gene sequence |
AGCGCCGTGGTGTAGCTGGCCAAGCATGCAGGGCTTTGGACCCTGAGACCCAGGTTCGAA |
Downstream region at tRNA end position |
tttattattt |
Secondary structure (Cloverleaf model) | >W1610020485 Gln TTG T ATtt tttattattt A - T G - C C - G G - C C - G C - G G - C T A T G G T C C A T C G A G | | | | | G G T G T G C C A G G C G + | | + T T C G C A T C A A G AGAC C - G A - T G - C G - C G - C C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |