Sequence ID | >W1610020541 |
Genome ID | ASMQ01000006 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Candidatus Aenigmarchaeum subterraneum subterraneum SCGC AAA011-O16 [ASMQ] |
Start position on genome | 3294 |
End posion on genome | 3368 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
aatctttaac |
tRNA gene sequence |
GGGCCCATAGCTCAGCCTGGTAGAGCGCTCGCCTCTTAAGCGATAGGTCGCGGGTTCAAA |
Downstream region at tRNA end position |
tataaacttt |
Secondary structure (Cloverleaf model) | >W1610020541 Lys CTT c ACat tataaacttt G - C G - C G - C C - G C - G C - G A - T T A T T G C C C A C G A A + | | | | A C C T C G G C G G G C T | | | | T T G G A G C G T A G AGGTC C T T - A C - G G - C C - G C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |