Sequence ID | >W1610020638 |
Genome ID | ASRH01000004 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Candidatus Aramenus sulfurataquae AZ1 [ASRH] |
Start position on genome | 69482 |
End posion on genome | 69556 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gataaaggga |
tRNA gene sequence |
GGGCCCGTCGTCTAGCCTGGTTAGGACGCTGCCCTTACAAGGCAGAGGTCCTGGGTTCAA |
Downstream region at tRNA end position |
ttttatattg |
Secondary structure (Cloverleaf model) | >W1610020638 Val TAC a Atac ttttatattg G - C G - C G - C C - G C - G C - G G - C T A T G A C C C A C C G A C | | | | | A T T C T G C T G G G C G + | | | T T G G G A C T T A G AGGTC C - G T - A G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |