Sequence ID | >W1610024429 |
Genome ID | AUMX01000011 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanocorpusculum bavaricum DSM 4179 [AUMX] |
Start position on genome | 24356 |
End posion on genome | 24271 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agtcaaaatT |
tRNA gene sequence |
GCGAGGGTTGCCAAGCCAGGTTAACGGCGCAGGGTTTAGGACCCTGTCTCTAGGAGTTCA |
Downstream region at tRNA end position |
ctttttctaa |
Secondary structure (Cloverleaf model) | >W1610024429 Leu TAG T ATtc ctttttctaa G - C C - G G - C A - T G - C G - C G - C T A T T T C C C A C C G A T | | | | | G A A C C G A A G G G C G | | | T T G C G G C T T A A G TCTCTAGGAGTTC C - G A - T G - C G - C G - C T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |