Sequence ID | >W1610024758 |
Genome ID | AUTB01000055 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sinorhizobium sp. GL2 [AUTB] |
Start position on genome | 137894 |
End posion on genome | 137970 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gccgttggca |
tRNA gene sequence |
CGGAGTGTAGCGCAGTCTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
ttcattgagg |
Secondary structure (Cloverleaf model) | >W1610024758 Pro TGG a ACCA ttcattgagg C - G G - C G - C A - T G - C T - A G - C T A T C T C T C A T G A A | + | | | G C C G C G G G G A G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |