Sequence ID | >W1610028388 |
Genome ID | AWOG01000042 |
Search identical group | |
Phylum/Class | Nanoarchaeota |
Species | Nanoarchaeota archaeon JGI OTU-1 [AWOG] |
Start position on genome | 415 |
End posion on genome | 491 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tattaaatcT |
tRNA gene sequence |
GGGCTCTTAGCTCAGCTTGGCTAGAGCACTTGCCTTTTAAGCAAGGGGTCGCGGGTTCGA |
Downstream region at tRNA end position |
ataacacaaa |
Secondary structure (Cloverleaf model) | >W1610028388 Lys TTT T GTtt ataacacaaa G - C G - C G - C C - G T + G C - G T - A T A T T G C C C A T C G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C C T A A GGGTC C - G T - A T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |