Sequence ID | >W1610032570 |
Genome ID | AZAC01000048 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Dethiosulfatarculus sandiegensis [AZAC] |
Start position on genome | 45398 |
End posion on genome | 45495 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
atttctgtgt |
tRNA gene sequence |
GGAAGTGGAAAGCTCACTGGTGGGGCTCCCGGACTTCAAATCCGGTGTACCGTCTGAGGA |
Downstream region at tRNA end position |
aagtgataac |
Secondary structure (Cloverleaf model) | >W1610032570 SeC(p) TCA t GCCA aagtgataac G - C G - C A - T A - T G - C T - A G - C G G T T A T A C C C A C A C A + | | | | G T T C G A G T G G G C G + | | | T T G G G C T T G G C TGTACCGTCTGAGGAAGGCGGTAG C - G C - G G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |