Sequence ID | >W1610032575 |
Genome ID | AZAC01000056 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Dethiosulfatarculus sandiegensis [AZAC] |
Start position on genome | 351903 |
End posion on genome | 351978 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
gcacataagt |
tRNA gene sequence |
GGTCCCATCGTCTAGTGGTCTAGGATATCGGCCTCTCACGCCGAAGACACGGGTTCGAGT |
Downstream region at tRNA end position |
agttatatca |
Secondary structure (Cloverleaf model) | >W1610032575 Glu CTC t GCCA agttatatca G + T G - C T - A C - G C - G C - G A - T T G T T G C C C A T G A C | | | | | G G T C T G A C G G G C G + | | + T T T G G A T C T A A AGAC T - A C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |