Sequence ID | >W1610032581 |
Genome ID | AZAJ01000001 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanolobus tindarius DSM 2278 [AZAJ] |
Start position on genome | 496816 |
End posion on genome | 496890 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cctacttcga |
tRNA gene sequence |
GCCGGGGTAGGGTAGCGGTTATCCTGTAGCCCTGTGGAGGCTACGATTCGAGTTCGATTC |
Downstream region at tRNA end position |
ttttttatat |
Secondary structure (Cloverleaf model) | >W1610032581 His GTG a CCCA ttttttatat G - C C - G C - G G - C G - C G - C G + T T T T A G C T C A C G A A | | | | | G G T G G G T C G A G C G | | + T T T T C C T T A G CGAT T - A A - T G - C C - G C - G C A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |