Sequence ID | >W1610032611 |
Genome ID | AZAJ01000001 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanolobus tindarius DSM 2278 [AZAJ] |
Start position on genome | 1430092 |
End posion on genome | 1430018 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aatcttctaT |
tRNA gene sequence |
GGGCTTGTAGATCAGTTGGAAGATCGTCGCCTTTGCAAGGCGAAGGCCCAGGGTTCGAAT |
Downstream region at tRNA end position |
ttagtgcact |
Secondary structure (Cloverleaf model) | >W1610032611 Ala TGC T ATta ttagtgcact G - C G - C G + T C - G T - A T - A G - C T A T G T C C C A T G A A | | | | | G T C T A G C A G G G C G | | | | T T G G A T C A A G AGGCC T - A C - G G - C C - G C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |