Sequence ID | >W1610032687 |
Genome ID | AZAY01000015 |
Search identical group | |
Phylum/Class | Thermotogota |
Species | Marinitoga sp. 1197 [AZAY] |
Start position on genome | 68024 |
End posion on genome | 67948 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
taagttaatt |
tRNA gene sequence |
GGGCTCGTAGCTCAGTTGGTGAGAGCTTCCGGCTCATAACCGGGAGGTCGGTGGTTCGAA |
Downstream region at tRNA end position |
aaacgacggg |
Secondary structure (Cloverleaf model) | >W1610032687 Met CAT t ACCA aaacgacggg G - C G - C G - C C - G T - A C - G G - C T A T C C A C C A T G A A | | | | | G T C T C G G G T G G C G | | | | T T G G A G C T G A T AGGTC T + G C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |