Sequence ID | >W1610041329 |
Genome ID | BANO01000009 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halarchaeum acidiphilum MH1-52-1 [BANO] |
Start position on genome | 11525 |
End posion on genome | 11452 |
Amino Acid | Pseudo |
Anticodon | GTG |
Upstream region at tRNA start position |
gagtgcagtg |
tRNA gene sequence |
TCCGGGTTGGGGTAGTGGACTATCCTTCAGCCTTGTGGAGGCTGAGACGCGGGTTCAATT |
Downstream region at tRNA end position |
ctctcgacga |
Secondary structure (Cloverleaf model) | >W1610041329 Pseudo GTG g CCtt ctctcgacga T - A C - G C - G G + T G - C G - C T - A T T T C G C T C A T G A G | | | + | A G T G G G G C G G G C G | | + T T A T C C T C T A T AGAC C - G A - T G - C C - G C - G T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |