Sequence ID | >W1610041342 |
Genome ID | BANO01000059 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halarchaeum acidiphilum MH1-52-1 [BANO] |
Start position on genome | 3929 |
End posion on genome | 4013 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atcgaggtgc |
tRNA gene sequence |
GCACGGGTAGCCAAGCTAGGCCAACGGCGCAGCGCTTAGGACGCTGTCCCGTAGGGGTCC |
Downstream region at tRNA end position |
gtctccgaag |
Secondary structure (Cloverleaf model) | >W1610041342 Leu TAG c Atcc gtctccgaag G - C C - G A - T C - G G - C G - C G - C T A T T G G C C A T C G A A + | | | | G A A C C G G C C G G C G | | | T T G C G G C C C A A G TCCCGTAGGGGTCC C - G A - T G - C C - G G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |