Sequence ID | >W1610043648 |
Genome ID | BAZY01000005 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoanaerobacter thermocopriae JCM 7501 [BAZY] |
Start position on genome | 118813 |
End posion on genome | 118889 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
agcaagaagt |
tRNA gene sequence |
GGGGTTATAGCTCAGCTGGTCAGAGCGCTACGTTGACATCGTAGAGGCCACAGGTTCGAA |
Downstream region at tRNA end position |
ttttttatat |
Secondary structure (Cloverleaf model) | >W1610043648 Val GAC t ACCA ttttttatat G - C G - C G - C G - C T - A T - A A - T T A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C T C A G AGGCC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |