Sequence ID | >W1610043721 |
Genome ID | BAZZ01000009 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoclostridium stercorarium subsp. thermolacticum JCM 9324 [BAZZ] |
Start position on genome | 74333 |
End posion on genome | 74408 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
aaaagagcat |
tRNA gene sequence |
CGGGGTGTGGCTCAGGTGGTAGAGCGCTTGGTTCGGGACCAAGAGGCCGCTGGTTCGAGT |
Downstream region at tRNA end position |
aaaccactct |
Secondary structure (Cloverleaf model) | >W1610043721 Pro CGG t ACCA aaaccactct C - G G - C G - C G + T G - C T - A G - C T G T T G A C C A G G A G + | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A G AGGCC C - G T - A T - A G - C G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |