| Sequence ID | >W1610046819 |
| Genome ID | BBCU01000002 |
| Phylum/Class | Euryarchaeota |
| Species | Thermococcus sp. JCM 11816 [BBCU] |
| Start position on genome | 162550 |
| End posion on genome | 162626 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
tctctccaga |
| tRNA gene sequence |
GGGCCCGTAGCCTAGCAGGATAGGGCGCCGGCCTTCTAAGCCGGAGGTCGCGGGTTCGAA |
| Downstream region at tRNA end position |
ttctcgaaat |
| Secondary structure (Cloverleaf model) | >W1610046819 Arg TCT
a GCCA ttctcgaaat
G - C
G - C
G - C
C - G
C - G
C - G
G - C T A
T C G C C C A
C G A A | | | | | G
A T C C G G C G G G C
G + | | | T T
G G G G C
A T A G AGGTC
C - G
C - G
G - C
G - C
C - G
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |