| Sequence ID | >W1610049048 |
| Genome ID | BBEQ01000029 |
| Phylum/Class | Bacillota |
| Species | Secundilactobacillus collinoides DSM 20515 = JCM 1123 [BBEQ] |
| Start position on genome | 35900 |
| End posion on genome | 35825 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
taacagcaaT |
| tRNA gene sequence |
CGGGAAGTAGCTCAGCTTGGTAGAGCACCACGTTCGGGACGTGGGGGTCGCAAGTTCAAA |
| Downstream region at tRNA end position |
tgattaccgc |
| Secondary structure (Cloverleaf model) | >W1610049048 Pro CGG
T ATag tgattaccgc
C - G
G - C
G - C
G - C
A - T
A - T
G + T T A
T T G T T C A
C G A A + | | | | A
T C T C G G C A A G C
T | | | | T T
G G A G C
G T A A GGGTC
C - G
C - G
A - T
C - G
G - C
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |