Sequence ID | >W1610049199 |
Genome ID | BBET01000114 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanobrevibacter arboriphilus JCM 13429 = DSM 1125 [BBET] |
Start position on genome | 1923 |
End posion on genome | 2009 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
atattatctT |
tRNA gene sequence |
GCCGAGATAGTCTAGCCTGGTAAGGCGCAAGACTGGAAATCTTGTGGGGATTTTCCCCGC |
Downstream region at tRNA end position |
attagtatat |
Secondary structure (Cloverleaf model) | >W1610049199 Ser GGA T GTtt attagtatat G - C C - G C - G G - C A - T G - C A - T T A T G A C C C A C G A A | | | | | A C T C T G C T G G G C T | | + | T T G A G G C G T A G TGGGGATTTTCCCCGC C - G A - T A - T G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |