Sequence ID | >W1610051397 |
Genome ID | BBGV01000408 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Nocardioides pyridinolyticus JCM 10369 [BBGV] |
Start position on genome | 320 |
End posion on genome | 413 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tcgctgtcgg |
tRNA gene sequence |
GGAGGCGTCGCCTAGTCCGGTCTATGGCGCCCGCCTGCTAAGCGGGTTTGGGGCTACAAC |
Downstream region at tRNA end position |
gcccacggcc |
Secondary structure (Cloverleaf model) | >W1610051397 Ser GCT g GCCA gcccacggcc G - C G - C A - T G - C G - C C - G G - C T A T C T C C C A C T G A C | | | | | A C T C C G G A G G G C G | | | T T G T G G C T C T A G TTTGGGGCTACAACCCCATC C - G C - G C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |