Sequence ID | >W1610057353 |
Genome ID | BBXF01000011 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Herbidospora daliensis [BBXF] |
Start position on genome | 121559 |
End posion on genome | 121633 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gacacaccga |
tRNA gene sequence |
CGCGGGGTGGAGCAGCTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
ttgaaaggcc |
Secondary structure (Cloverleaf model) | >W1610057353 Met CAT a ACtg ttgaaaggcc C T G - C C - G G - C G - C G - C G - C T A T T G T C C A C G A G + | | | | A T C G A G G C A G G C C | | | | T T G G C T C G T A G AGGTC C - G T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |