Sequence ID | >W1610058142 |
Genome ID | BBZP01000105 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridia bacterium UC5.1-1A9 [BBZP] |
Start position on genome | 17999 |
End posion on genome | 18087 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aaatcaaccg |
tRNA gene sequence |
GCAGAAGTACCCAAGAGGTTGAAGGGGCTCCCCTGGAAAGGGAGTAGGTCGTTAGTAGCG |
Downstream region at tRNA end position |
gcatcaccgg |
Secondary structure (Cloverleaf model) | >W1610058142 Ser GGA g Gtga gcatcaccgg G - C C - G A - T G - C A - T A - T G - C T A T C T C C C A A G A A | | | | | A G A C C C G A G G G C G | | | T T T A G G G T G A G TAGGTCGTTAGTAGCGGCGC C - G T - A C - G C - G C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |