Sequence ID | >W1610061905 |
Genome ID | BCNA01000001 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloarcula sp. CBA1128 [BCNA] |
Start position on genome | 2357005 |
End posion on genome | 2357077 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aataagcgtG |
tRNA gene sequence |
TCCGGGTTGGGGTAGTGGTATCCTTCAGCCTTGTGGTGGCTGAGACGTGGGTTCAATTCC |
Downstream region at tRNA end position |
atcaattttc |
Secondary structure (Cloverleaf model) | >W1610061905 His GTG G CTgt atcaattttc T - A C - G C - G G - C G - C G - C T - A T T T C G C C C A G A G | + | | | A T T G G G G T G G G C G | | + T T G T C C T T A T AGAC C - G A - T G - C C - G C - G T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |