Sequence ID | >W1610061912 |
Genome ID | BCNA01000001 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloarcula sp. CBA1128 [BCNA] |
Start position on genome | 2555308 |
End posion on genome | 2555235 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgaatagcga |
tRNA gene sequence |
GGGCCGGTAGCTCAGTTAGGCAGAGCGTCTGGCTTTTAACCAGATGGTCGGGGGTTCAAC |
Downstream region at tRNA end position |
aacgaaccga |
Secondary structure (Cloverleaf model) | >W1610061912 Lys TTT a Gtgc aacgaaccga G - C G - C G - C C - G C - G G - C G - C T C T C T C C C A T G A A | + | | | A T C T C G G G G G G C A | | | | T T G G A G C G C A G TGGTC T - A C - G T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |