Sequence ID | >W1610070542 |
Genome ID | BCTI01000033 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Hydrogenophaga intermedia NBRC 102510 [BCTI] |
Start position on genome | 56843 |
End posion on genome | 56919 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttggcttga |
tRNA gene sequence |
CGCGGAGTGGAGCAGCCTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGCAAGTTCAAA |
Downstream region at tRNA end position |
acaaaatcaa |
Secondary structure (Cloverleaf model) | >W1610070542 Met CAT a ACCA acaaaatcaa C A G - C C - G G - C G - C A - T G - C T A T C G T T C A C G A G | | | | | A C C G A G G C A A G C T | | | | T T G G C T C G T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |