Sequence ID | >W1610072230 |
Genome ID | BCUT01000008 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Variovorax paradoxus NBRC 15149 [BCUT] |
Start position on genome | 135571 |
End posion on genome | 135496 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aattggttcc |
tRNA gene sequence |
GGGACGTTAGCTCAGTTGGTAGAGCAGCGGACTTTTAATCCGTTGGTCACTGGTTCGAAT |
Downstream region at tRNA end position |
gacccctcca |
Secondary structure (Cloverleaf model) | >W1610072230 Lys TTT c ACCA gacccctcca G + T G - C G - C A - T C - G G - C T - A T A T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C T A A TGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |