Sequence ID | >W1610073249 |
Genome ID | BCVU01000035 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Ligilactobacillus ruminis DSM 20403 = NBRC 102161 [BCVU] |
Start position on genome | 17079 |
End posion on genome | 17004 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
atattgataT |
tRNA gene sequence |
GCACCCATAGCGCAACTGGATAGAGTGTCTGACTACGAATCAGAAGGTTGTAGGTTCGAC |
Downstream region at tRNA end position |
tttagtggtc |
Secondary structure (Cloverleaf model) | >W1610073249 Arg ACG T ATtt tttagtggtc G - C C - G A - T C - G C - G C - G A - T T C T C A T C C A C A A A | | | | | G T C G C G G T A G G C G | | + T T G G A G T A T A G AGGTT T - A C - G T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |