Sequence ID | >W1610075184 |
Genome ID | BCXT01000061 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium breve [BCXT] |
Start position on genome | 43815 |
End posion on genome | 43903 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aacgacacct |
tRNA gene sequence |
GCCCGGGTGGCGGAATGGTAGACGCGCTAGCTTGAGGTGCTAGTGCCTATTTTTAACGGG |
Downstream region at tRNA end position |
ataaacccct |
Secondary structure (Cloverleaf model) | >W1610075184 Leu GAG t ACag ataaacccct G - C C - G C - G C - G G - C G + T G - C T G T T G C C C A T A A G | | | | | A G G G C G A C G G G C G | | | T T T A C G C A G G TGCCTATTTTTAACGGGCGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |