Sequence ID | >W1610076883 |
Genome ID | BCZC01000006 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingobium chlorophenolicum NBRC 16172 [BCZC] |
Start position on genome | 357 |
End posion on genome | 281 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ccgcgagcgc |
tRNA gene sequence |
CGGGGAGTAGCGCAGTCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
ccttctggcg |
Secondary structure (Cloverleaf model) | >W1610076883 Pro TGG c ACCA ccttctggcg C - G G - C G - C G - C G - C A - T G - C T A T T G T C C A T G A A + | | | | G C C G C G G C A G G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |