Sequence ID | >W1610078246 |
Genome ID | BDAT01000002 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Alcanivorax sp. NBRC 102028 [BDAT] |
Start position on genome | 76891 |
End posion on genome | 76816 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cttcgggagc |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGCTGGTTCGAAT |
Downstream region at tRNA end position |
tatttaaaag |
Secondary structure (Cloverleaf model) | >W1610078246 Lys TTT c ACCA tatttaaaag G - C G - C G - C T - A C - G G - C T - A T A T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |