Sequence ID | >W1610079030 |
Genome ID | BDBI01000025 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Nocardia ignorata NBRC 108230 [BDBI] |
Start position on genome | 190203 |
End posion on genome | 190278 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
aaatcgtcct |
tRNA gene sequence |
GGCCCCGTCGTCTAGCGGCCTAGGACGCCGCCCTCTCAAGGCGGTAGCGCGGGTTCGAAT |
Downstream region at tRNA end position |
agaaaggccc |
Secondary structure (Cloverleaf model) | >W1610079030 Glu CTC t ACCA agaaaggccc G + T G - C C - G C - G C - G C - G G - C T A T T G C C C A C G A C + | | | | G G T C T G G C G G G C G + | | | T T C G G A C C T A G TAGC C - G C - G G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |