Sequence ID | >W1610083275 |
Genome ID | CBVY010000032 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorubrum sp. AJ67 [CBVY] |
Start position on genome | 7705 |
End posion on genome | 7619 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ccggctgcgT |
tRNA gene sequence |
GCGAGGGTAGCCAAGCCCGGAAACGGCGGCGGATTCAAGCTCCGCTCCTGTAGAGGTCCG |
Downstream region at tRNA end position |
ccggggtcaa |
Secondary structure (Cloverleaf model) | >W1610083275 Leu CAA T ATCg ccggggtcaa G - C C - G G - C A - T G - C G - C G - C T A T C T C C C A C C G A A | | | | A C A C C G G T G G G C G | | | T T G C G G C A A A G TCCTGTAGAGGTCC G - C C - G G - C G - C A - T T C T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |