| Sequence ID | >W1610083320 |
| Genome ID | CBXV010000006 |
| Phylum/Class | Acidobacteriota |
| Species | Pyrinomonas methylaliphatogenes [CBXV] |
| Start position on genome | 94591 |
| End posion on genome | 94675 |
| Amino Acid | Leu |
| Anticodon | GAG |
| Upstream region at tRNA start position |
tctcctgcgt |
| tRNA gene sequence |
GCCGAAGTGGCGGAATTGGTAGACGCGCACGTTTGAGGGGCGTGTGAGGCAACTCGTGTG |
| Downstream region at tRNA end position |
aatcttctcc |
| Secondary structure (Cloverleaf model) | >W1610083320 Leu GAG
t ACCA aatcttctcc
G - C
C - G
C - G
G - C
A - T
A - T
G - C T G
T C A C C C A
T A A G | | | | | G
T G G C G G T G G G C
G | | | T T
G A C G C
T A G G TGAGGCAACTCGT
C - G
A - T
C - G
G - C
T + G
T G
T G
G A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |