Sequence ID | >W1610085257 |
Genome ID | CEMR01000001 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halobacterium hubeiense JI20-5 [CEMR] |
Start position on genome | 141571 |
End posion on genome | 141655 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gtcggagtgc |
tRNA gene sequence |
GCGCGGGTAGCCAAGCCAGGAAAAGGCGTAGCGCTTAGGACGCTATCCCGTAGGGGTCCG |
Downstream region at tRNA end position |
actgagtttt |
Secondary structure (Cloverleaf model) | >W1610085257 Leu TAG c ACtg actgagtttt G - C C - G G - C C - G G - C G - C G - C T A T T G G C C A C C G A A + | | | | A A A C C G G C C G G C G | | | T T G A G G C A A A G TCCCGTAGGGGTCC T - A A - T G - C C - G G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |