Sequence ID | >W1610092885 |
Genome ID | CYSD01000042 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Tritonibacter multivorans [CYSD] |
Start position on genome | 3758 |
End posion on genome | 3831 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
acacccacga |
tRNA gene sequence |
GCGGGTATGGTGAAATGGTATCATAAGAGCCTTCCAAGCTTAAGGTGCGGGTTCGATTCC |
Downstream region at tRNA end position |
gggtgttccc |
Secondary structure (Cloverleaf model) | >W1610092885 Gly TCC a TCCA gggtgttccc G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A A A G | | | | | G T A G T G G C G G G C G | | | + T T G T C A T T A A AGGT A A G + T A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |