Sequence ID | >W1610094218 |
Genome ID | CYTO01000024 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Cognatishimia activa CECT 5113 [CYTO] |
Start position on genome | 631640 |
End posion on genome | 631565 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ctgcgtcacc |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCGCTTCGTTTACACCGAAGATGTCGGGAGTTCGAGC |
Downstream region at tRNA end position |
tcatcccccg |
Secondary structure (Cloverleaf model) | >W1610094218 Val TAC c ACCA tcatcccccg G - C G - C G - C T - A C - G G - C T - A C G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |