Sequence ID | >W1610098505 |
Genome ID | CYXW01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Turicibacter sanguinis [CYXW] |
Start position on genome | 6 |
End posion on genome | 82 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
nnnnnataat |
tRNA gene sequence |
GGCCCGTTGGTGAAGCGGTTTAACACACATGCCTTTCACGCATGCATACACGGGTTCGAA |
Downstream region at tRNA end position |
tttattagtg |
Secondary structure (Cloverleaf model) | >W1610098505 Glu TTC t ACCA tttattagtg G - C G + T C - G C - G C - G G - C T - A T A T T G C C C A C G A G | | | | | G G A G T G A C G G G C G | | | T T T A C A C T T A A CATAC C - G A - T T - A G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |