Sequence ID | >W1610101180 |
Genome ID | CYZN01000029 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Blautia wexlerae [CYZN] |
Start position on genome | 28629 |
End posion on genome | 28555 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
taaagaaaat |
tRNA gene sequence |
GGCGAGATAGCTCAGTTGGCTAGAGCACACGGTTCATACCCGTGGTGTCGAGGGTTCGAA |
Downstream region at tRNA end position |
gacagagaaa |
Secondary structure (Cloverleaf model) | >W1610101180 Met CAT t ACtt gacagagaaa G + T G - C C - G G - C A - T G - C A - T T A T C C C C C A T G A A | | | | G T C T C G G A G G G C G | | | | T T G G A G C C T A A GTGTC C - G A - T C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |