Sequence ID | >W1610101344 |
Genome ID | CYZQ01000053 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Turicibacter sanguinis [CYZQ] |
Start position on genome | 518 |
End posion on genome | 430 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
nnnnnnnnnt |
tRNA gene sequence |
GCCTGGGTGGCGGAACTGGTAGACGCACAGGACTTAAAATCCTGCGGGTGGTGACACCCG |
Downstream region at tRNA end position |
attttattat |
Secondary structure (Cloverleaf model) | >W1610101344 Leu TAA t ACCA attttattat G - C C - G C - G T - A G + T G - C G - C T T T C G G C C A C A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T A G A CGGGTGGTGACACCCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |