Sequence ID | >W1610104025 |
Genome ID | CZBK01000010 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Phocaeicola vulgatus [CZBK] |
Start position on genome | 69847 |
End posion on genome | 69918 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ataggaaaat |
tRNA gene sequence |
TGGGATATGGTGTAATGGTAACACAACAGATTCTGGTCCTGTTTTTCCAGGTTCGAATCC |
Downstream region at tRNA end position |
acaaatcact |
Secondary structure (Cloverleaf model) | >W1610104025 Gln CTG t ACag acaaatcact T - A G - C G - C G - C A - T T - A A - T T A T G G T C C A A A G | | | | | G T T G T G C C A G G C G | | | | T T G A C A C T A A TTTT A - T C - G A - T G - C A C T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |