Sequence ID | >W1610112431 |
Genome ID | CZJW01000034 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Kocuria rhizophila [CZJW] |
Start position on genome | 76784 |
End posion on genome | 76857 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
cacgcgagca |
tRNA gene sequence |
CGGGGTGTAGCGCAGTGGCTAGCGCGCCTGCTTTGGGAGCAGGAGATCGCAGGTTCGAGT |
Downstream region at tRNA end position |
ctgggcactg |
Secondary structure (Cloverleaf model) | >W1610112431 Pro TGG a ACgt ctgggcactg C - G G - C G - C G - C G - C T - A G - C T G T T G T C C A T G A A + | | | | G G C G C G G C A G G C G | | | | T T C G C G C T A G AGATC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |