Sequence ID | >W1610112459 |
Genome ID | CZJW01000056 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Kocuria rhizophila [CZJW] |
Start position on genome | 29656 |
End posion on genome | 29741 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtgtttgcct |
tRNA gene sequence |
GGAGGATTCGCCTAGCGGCCTATGGCGCACGCCTGGAACGCGTGTTGGGTTAACGCCCTC |
Downstream region at tRNA end position |
caccgctaag |
Secondary structure (Cloverleaf model) | >W1610112459 Ser GGA t GCat caccgctaag G - C G - C A - T G - C G - C A - T T - A T A T C C C C C A C G A C | | | | | A G T C C G G G G G G C G | | | T T C T G G C C T A G TTGGGTTAACGCCCTC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |