Sequence ID | >W1610112589 |
Genome ID | CZLD01000015 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium neonatale [CZLD] |
Start position on genome | 23635 |
End posion on genome | 23561 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
accaaataat |
tRNA gene sequence |
GCGTGAGTGACTCAATGGTAGAGTGCCACCTTGCCAAGGTGGAAGTTGCGGGTTCGAGTC |
Downstream region at tRNA end position |
tttttaaaca |
Secondary structure (Cloverleaf model) | >W1610112589 Gly GCC t TCCA tttttaaaca G - C C - G G - C T + G G - C A - T G - C T G T T G C C C A A A G + | | | | G T C T C A G C G G G C G | | | | T T G G A G T T A G AAGTT C - G C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |