Sequence ID | >W1610131015 |
Genome ID | CZZX01000345 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile [CZZX] |
Start position on genome | 332 |
End posion on genome | 407 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tattcttcat |
tRNA gene sequence |
AGGGGTGTAGCTCAGTTGGTAGAGCGTCGGTCTCCAAAACCGTGCGCCGGGGGTTCGAGT |
Downstream region at tRNA end position |
aataaaaagg |
Secondary structure (Cloverleaf model) | >W1610131015 Trp CCA t GCCA aataaaaagg A - T G - C G - C G - C G - C T - A G - C T G T C T C C C A T G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A G GCGCC T T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |