Sequence ID | >W1610137534 |
Genome ID | FACY01000101 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile [FACY] |
Start position on genome | 457 |
End posion on genome | 533 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tataaattgt |
tRNA gene sequence |
GGGTGCATAGCTCAGCTGGATAGAGCAACGCCCTTCTAAGGCGTGTGTCCGGGGTTCGAA |
Downstream region at tRNA end position |
catatatatt |
Secondary structure (Cloverleaf model) | >W1610137534 Arg TCT t ACCA catatatatt G - C G + T G - C T + G G - C C - G A - T T A T G T C C C A C G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C A T A A GTGTC A - T C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |