Sequence ID | >W121073503 |
Genome ID | AJZR01000011 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Capnocytophaga sp. oral taxon 412 oral taxon 412 str. F0487 [AJZR] |
Start position on genome | 15989 |
End posion on genome | 15907 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttaaaaagga |
tRNA gene sequence |
GCCTGAGTGGCGGAATTGGTAGACGCGCACGACTCAAACTCGTGTTCTTCGGAGTGAGGG |
Downstream region at tRNA end position |
taaaaggagc |
Secondary structure (Cloverleaf model) | >W121073503 Leu CAA a ACAA taaaaggagc G + T C - G C - G T - A G - C A - T G - C T T T C T C C C A T A A G | | | | | G T G G C G G A G G G C G | | | T T G A C G C T A G G TTCTTCGGAGT C - G A - T C - G G - C A - T C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |