Sequence ID | >W1610141308 |
Genome ID | FAER01000198 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile [FAER] |
Start position on genome | 849 |
End posion on genome | 776 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccaaaaaggc |
tRNA gene sequence |
GGCGACATAGCCAAGTGGTAAGGCAGTGGACTGCAACTCCTTGATCCCCAGTTCGAATCT |
Downstream region at tRNA end position |
aaatattcca |
Secondary structure (Cloverleaf model) | >W1610141308 Cys GCA c TCCA aaatattcca G - C G - C C - G G - C A - T C - G A - T T A T G G G T C A G A A | | | | | G T A C C G C C C A G C G | | | T T G A G G C T A A GATC G + T T T G - C G - C A - T C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |