Sequence ID | >W1610143965 |
Genome ID | FAFW01000191 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile [FAFW] |
Start position on genome | 1555 |
End posion on genome | 1481 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aaataggtgt |
tRNA gene sequence |
GCTGGTGTGGCTCAACGGTAGAGCAGCTGACTTGTAATCAGCAGGTTGTAGGTTCGATTC |
Downstream region at tRNA end position |
gtaaagacta |
Secondary structure (Cloverleaf model) | >W1610143965 Thr TGT t TCCA gtaaagacta G - C C - G T - A G - C G - C T - A G - C T T T T A T C C A A A G + | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A AGGTT G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |