Sequence ID | >W1610156986 |
Genome ID | FALS01000041 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile [FALS] |
Start position on genome | 1215 |
End posion on genome | 1290 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tgaatagcga |
tRNA gene sequence |
GGGATTATAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCACAGGTTCGAGC |
Downstream region at tRNA end position |
gtgcaaacct |
Secondary structure (Cloverleaf model) | >W1610156986 Val TAC a ACCA gtgcaaacct G - C G - C G - C A - T T - A T - A A - T C G T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |