Sequence ID | >W121069919 |
Genome ID | AJVZ01000007 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Prevotella bivia DSM 20514 [AJVZ] |
Start position on genome | 368 |
End posion on genome | 444 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aagaatgcag |
tRNA gene sequence |
CGGGGTGTAGCGCAGCCCGGTAGCGCTCCTGGTTTGGGACCAGGCGGCCGCAGGTTCGAA |
Downstream region at tRNA end position |
aatttagtca |
Secondary structure (Cloverleaf model) | >W121069919 Pro TGG g ACAA aatttagtca C - G G - C G - C G - C G - C T + G G - C T A T T G T C C A C G A A + | | | | G C C G C G G C A G G C C | | | | T T G G C G C G T A T CGGCC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |